Forget about your mouse from now on. In the shell, only your keyboard will take you where you wanna be…
This is your shell prompt, and it looks like this whenever it’s ready to accept your commands (input):
your_username_here $
When you have your prompt, you communicate with the computer by typing a command and hitting enter
to run it.
In computer words, ‘typing a command’ is accepting input from keyboard (from your keyboard… you!). This is called standard input (stdin).
When you run a command, the computer prints the output on the screen. This is called standard output (stdout).
Some commands are stand-alone, e.g. date
, ls
, and cal
, which means that you don’t necessarily have to input anything, because they have a default input.
$ date
Wed Mar 7 09:39:26 CST 2018
Try running
cal
andls
. What’s the output?
The majority of the commands we’ll use, e.g. cat
and less
, require some input. You can simply do this by redirecting stdin. To redirect stdin, you can use <
$ cat < mgrisea_mat1_aa.txt
>lcl|AB080670.2_prot_BAC65087.1_1_[gene=MAT1-1-1]_alpha_box
MIASLSPDDIARLIPQETLTSLLRANDEKERLRELPVSPRAVAAASKNKKKVNGFMAFRSYYAGIFQDRPQKERSPFITLLWQKETLKSRWTLMANVFSRIRDFAGTTRGRMAMSGFLRVACPLLGITKPCDYLRRYNWELEFVADASAPYDAAMKYEISQSQIPHIVDEFEVPTTEIELLRACVQGGFPFENSAQLLRDMEDSSVTVMTRTAPIMAPSHASQASHGQHNHHFINTLINDPDAAISALLPQDEDIGSLMVDMNIIHSLETDSSTTSSARNSVSPLEQHLFFHEDVSIDPSTMVSFPGEGHGHPETQYSYPNPTLGLW
or, you can simply omit <
$ cat mgrisea_mat1_aa.txt
>lcl|AB080670.2_prot_BAC65087.1_1_[gene=MAT1-1-1]_alpha_box
MIASLSPDDIARLIPQETLTSLLRANDEKERLRELPVSPRAVAAASKNKKKVNGFMAFRSYYAGIFQDRPQKERSPFITLLWQKETLKSRWTLMANVFSRIRDFAGTTRGRMAMSGFLRVACPLLGITKPCDYLRRYNWELEFVDASAPYDAAMKYEISQSQIPHIVDEFEVPTTEIELLRACVQGGFPFENSAQLLRDMEDSSVTVMTRTAPIMAPSHASQASHGQHNHHFINTLINDPDAAISALLPQDEDIGSLMVDMNIIHSLETDSSTTSSARNSVSPLEQHLFFHEDVSIDPSTMVSFPGEGHGHPETQYSYPNPTLGLW
The output of these commands is printed on the screen (stdout).
The stdout on the screen means that:
1. Output is not being stored anywhere in any form
2. The command is not altering the original data
whoami
prints your username.$ whoaim
nathalia
pwd
stands for print current working directory. It prints your current location, aka path
.$ pwd
/home/nathalia
What kind of path is this?
ls
lists files and directories in your current directory$ ls
This prints the listing to the screen. If empty, won’t print anything.
ls
is a command that has options, which modify the default behavior of a command. In the case of ls
, options consist of a dash and one or more characters such as ls -l
$ ls -l
Did you notice a different in listing display?
You: Natty, I love options. I wanna see all options for ls! Natty: You can check out the manual page for all the options available!
For any command, man
opens up the manual page of any command as a kind of pop-up window.
$ man ls
LS(1) User Commands LS(1)
NAME
ls - list directory contents
SYNOPSIS
ls [OPTION]... [FILE]...
DESCRIPTION
List information about the FILEs (the current directory by default). Sort entries alphabetically if none of
-cftuvSUX nor --sort.
Mandatory arguments to long options are mandatory for short options too.
-a, --all
do not ignore entries starting with .
-A, --almost-all
do not list implied . and ..
--author
with -l, print the author of each file
-b, --escape
print octal escapes for nongraphic characters
--block-size=SIZE
use SIZE-byte blocks. See SIZE format below
-B, --ignore-backups
do not list implied entries ending with ~
-c with -lt: sort by, and show, ctime (time of last modification of file status information) with -l: show
ctime and sort by name otherwise: sort by ctime
(...)
Hit q
to exit and return to the command-line.
You: But, Nathy, what’s your favorite flag?
Natty: I am so glad you asked!
$ ls -lhtr
Test it out. Search the
man
pages, and figure out what each options does.
mkdir
stands for make a directory, and it requires input directory name. It should be a new name, never duplicate names.$ mkdir workshop_mar17
Hit
ls
.
We created the directory, however we are not inside yet.
cd
is the command to change directories. This commands requires input directory name that should be immediately where you are (aka, your working directory).$ cd workshop_mar17
Hit
pwd
.
Let’s say we wanted to go back to our /home
. There are multiple ways to do that:
Option 1:
$ cd ~
Option 2:
$ cd
Option 3:
$ cd /home/*your_username_here*
With cd
we can move across different levels of directory hierarchy if you input a path
.
The figure below is a representation of a file system. Let’s pause for 2 minutes to check this out.
Your prompt is in /home
. Now, try to answer these questions quickly without coding:
- What’s the command to change directory to aa_sequences/
?
- What’s the command to change directory to cowboy_scripts/
?
- What’s the command to change directory to annotation/
?
Now, your prompt is in /annotation
. Try to answer these questions quickly without coding:
- What do you see inside this directory?
- What’s the command to change directory to workshop_mar17/
?
.
(dot) represents the current directory.
..
(two dots, no spaces) represents the parent directory.
Hit the tab
for autocompletion of file names and paths.
Bash keeps history of your commands. Hit the up-arrow key to scroll through.
Going back to where we were… Let’s go back inside workshop_mar17/
.
$ cd workshop_mar17
nano
is a very basic text editor, and very easy to learn.Let’s create a fasta file named example_sequence.fasta
:
Notice the extension of the file: .fasta
. What does that mean to the computer?
$ nano example_sequence.fasta
GNU nano 2.0.6 File: example_sequence.fasta
[ New File ]
^G Get Help ^O WriteOut ^R Read File ^Y Prev Page ^K Cut Text ^C Cur Pos
^X Exit ^J Justify ^W Where Is ^V Next Page ^U UnCut Text ^T To Spell
When you hit enter
, the text editor appears on your screen. Notice the file name on the top. And on the bottom of the screen, notice keyboard shortcuts… remember that your mouse isn’t gonna work here.
Let’s create hypothetical nucleotide sequences.
GNU nano 2.0.6 File: example_sequence.fasta
>hypothetical_nucleotide_1
ATCTGATCGATCGATCGATATCTTTTTTAGCTAGG
>hypothetical_nucleotide_2
ACTAGCTAGCTATTACGGGGGGCTAGCTAGCTAGCGGGATCGATTTA
>hypothetical_nucleotide_3
ATCGATCGATCGAAAAAATCGATTTTCGATCGATCGATCGA
[ New File ]
^G Get Help ^O WriteOut ^R Read File ^Y Prev Page ^K Cut Text ^C Cur Pos
^X Exit ^J Justify ^W Where Is ^V Next Page ^U UnCut Text ^T To Spell
I just finish typing the last nucleotide sequence, and… I don’t really like these headers anymore. Let’s change them.
Use your arrow-keys to move up to rename headers.
GNU nano 2.0.6 File: example_sequence.fasta
>nucleotide_sequence_1
ATCTGATCGATCGATCGATATCTTTTTTAGCTAGG
>nucleotide_sequence_2
ACTAGCTAGCTATTACGGGGGGCTAGCTAGCTAGCGGGATCGATTTA
>nucleotide_sequence_3
ATCGATCGATCGAAAAAATCGATTTTCGATCGATCGATCGA
[ New File ]
^G Get Help ^O WriteOut ^R Read File ^Y Prev Page ^K Cut Text ^C Cur Pos
^X Exit ^J Justify ^W Where Is ^V Next Page ^U UnCut Text ^T To Spell
Great! Looks much better.
To exit nano
and save the file, hit crtl+X
. Notice that a new message appears on the bottom of the screen:
Save modified buffer (ANSWERING "No" WILL DESTROY CHANGES) ?
Y Yes
N No ^C Cancel
Because we just created this file (made changes to it), nano
is asking if we want to save what we just typed. If all looks good, hit Y
.
Another new message appears:
File Name to Write: example_sequence.fasta
^G Get Help ^T To Files M-M Mac Format M-P Prepend
^C Cancel M-D DOS Format M-A Append M-B Backup File
nano
wants to make sure you want to save what you typed as the file name you provided. If all looks good, hit enter
and you are back in the command-line.
Let’s create a new directory:
$ mkdir testings
cp
, which stands for copy.If you want to create a duplicate of the file in the same directory you must provide a new name for the duplicate:
$ cp example_sequence.fasta nucleotide_sequences.fasta
If you want to creat a copy of the file in testings/
you must provide the path
to the directory (don’t provide a new name):
$ cp example_sequence.fasta testings/
$ ls testings/
example_sequence.fasta
In our current directory, you should have:
$ ls
example_sequence.fasta nucleotide_sequences.fasta testings/
mv
stands for move, but you also use it to rename files.To rename a file:
$ mv example_sequence.fasta original_nucleotide_sequences.fasta
$ ls
nucleotide_sequences.fasta original_nucleotide_sequences.fasta testings/
Create a new directory named original
:
$ mkdir original
To move original_nucleotide_sequences.fasta
into original/
:
$ mv original_nucleotide_sequences.fasta original/
To move a file:
$ mv file_name_A directory_name_B/
To rename a file:
$ mv file_name_A file_name_B
rm
that stands for remove.A word of caution here: when you remove a file from the command-line, the file is removed forever and there is no way to recover it.
With rm
THERE IS NO GOING BACK!
$ rm nucleotide_sequences.fasta
$ ls
original/ testings/
rm -r
.THERE IS NO GOING BACK!
$ rm -r testings/
$ ls
original/
If a directory is empty, you can use rmdir
. If a directory isn’t empty, use rm -r
.
Yup… it’s gone!